2.2.3 Exercise: Comparing sequences
1 Comparing sequences using GC content
You have five DNA strands, but you don’t know the actual sequences.
- 0.45
- 0.55
- 0.50
- 0.45
- 0.55
1.1 Question 1
Using only the GC content as criterium, which ones of these sequences may actually be the same?
1.2 Question 2
Sort these sequences, from the least heat-resistant to the most heat-resistant.
1.3 Question 3
Write a sequence that has a GC content of 0.4.
2 Comparing sequences using nucleotides
You have three DNA strands:
TACGTATGCTATGCCGTAACGCTACGGATC
2.1 Question 4
Calculate the GC content for each sequence. Are they similar or not?
2.2 Question 5
Draw dot plots comparing all sequences. You should have three dot plots, comparing 1-2, 1-3 and 2-3. Draw the first one vertically, and the second one horizontally.
2.3 Question 6
For each pair of sequences, write the common subsequences between them that have at least three nucleotides. Use the dot plot to find these subsequences.